Carnaval Macabro

Bem vindo à "festa da carne"!

ResearchBlogging.orgPreparado para curtir o carnaval? Beber bastante, soltar as frangas, viver como se o mundo fosse acabar? Parabéns! Isso significa que você está vivendo o pré-apocalipse do jeito certo! Mas se você não gostar muito de carnaval e das coisas que todo mundo faz nessa época: dane-se! Você sabe que o mundo não passa desse ano mesmo!

Guerra, Fome, Peste… Escolha o seu cavaleiro do apocalipse. Se é para ser antinatural e apelativo, escolho então algo entre a Peste e a Morte. Escolho Zumbis! Vamos divagar como essas criaturas hipotéticas podem existir, e se existirem, se nós realmente estaríamos perdidos. Além de como a Biologia Sintética pode dar um empurrãozinho nisso tudo, é claro.

Jumbie, Nzambi, Zonbi… Zumbi!

Feiticeiro Haitiano, "bokor"

Apesar das referências folclóricas europeias envolvendo indivíduos que insistem em não admitir que estão mortos (como espíritos amaldiçoados e vampiros), as grandes influências na noção popular do Zumbi de hoje são mais africanas (e de outras culturas derivadas do continente mãe). Em especial no Haiti, onde o Vodu (Voodoo) é ainda culturalmente marcante. Até existem “feiticeiros” que trazem os “mortos à vida”.

Existem vários tipos de Zumbi, que podem ser classificados à partir da maneira como eles se tornam “mortos-vivos”. Acho que é possível separar o joio do trigo em duas classificações iniciais: “punição divina”, e “coquetel de substâncias” (drogas) ou “doença bizarra”. Como vamos falar de algo mais científico prefiro não comentar como um deus raivoso (ou simplesmente sacana) pode criar coisas meio-mortas .

Dorgas Zumbi

"Cadê as minhas Dorgas!?"

Os Zumbis existem de verdade, sem brincadeira. Pelo menos aqueles criados com um coquetel de substâncias. Há anos no Haiti existe o “processo de zumbificação”, em que “feiticeiros” (chamados de bokor) preparam um poderoso (e controverso) coquetel de substâncias que, segundo os praticantes do ritual, podem trazer pessoas aparentemente mortas à vida, mas sem vontade própria, sem personalidade. No caso, o indivíduo não é realmente um “morto”-vivo: fica mais para um “dopadão”-vivo.

Essa história é fascinante demais para algum cientista – e portanto nerd – não se importar. Por isso, lá nos idos dos anos 80, um canadense chamado Wade Davis viajou até o Caribe para escrever – talvez um dos primeiros estudos sobre Zumbis – o que se tornou um marco da “etnofarmacologia” (estudos de potenciais agentes farmacológicos através de referências etnográficas – resumindo: é quando um cientista “vai lá” ver se realmente faz sentido as mandigas xamânicas que a sua vó usa para curar seus “resfriados”): o best seller “The Serpent and the Rainbow” (“A Serpente e o Arco-íris” – tem um filme de terror mesmo nome baseado no livro). Nele, além das narrativas de viagem pelo Haiti, Davis documentou através de dois “informantes” duas receitas do “veneno Zumbi”, além de narrar seus efeitos nos “rituais” que presenciou. Como eu não quero ninguém criando Zumbis por aí e botando a culpa em mim, só vou mostrar os ingredientes que o Dr. Davis encontrou (como consegui-los e preparar o negócio é segredo!). Dê uma olhada aqui.

Dessa lista, os ingredientes mais interessantes são os peixes. Deles é possível obter duas neurotoxinas poderosas, componentes chave da zumbificação, induzindo catalepsia ou paralisia motora: a saxitoxina e a tetroxina (TTX). Outros sintomas dessas substâncias incluem:

  • Entorpecimento (“paralisia”) da face e de outras áreas
  • Paralisia motora das extremidades
  • Descoordenação
  • Fala “arrastada”
  • Pupilas dilatadas

Tudo isso com o indivíduo ainda consciente e com seus reflexos inalterados. Até nos piores filmes trash sobre zumbis essas características estão presentes na pantomima do ator.

Davis afirmou em sua tese de PhD que o uso do coquetel de neurotoxinas do “Zombie Poison” pode causar danos no sistema nervoso, em especial devido à TTX. Alucinógenos , bem como os danos das neurotoxinas poderiam adicionar aquele conhecido comportamento demente dos zumbis aos sintomas ditos anteriormente.

O Escândalo Científico

OK, vocês acharam que os cientistas iriam acreditar nessa história de Zumbis sem ser detalhadamente bem contada!? Sim: o senhor Davis causou um reboliço. Por cinco motivos principais:

“Indiana Jones”

Foi assim que muitos antropólogos criticaram o texto do primeiro livro de Davis, que mistura relatório científico, narrativa de viagem e história de aventura. Uma senhora pseudociência. Claramente atingido pelas críticas, Davis escreveu outro livro (“Passage of Darkness”). Mais acadêmico, agradando grande parte dos críticos:  “[O livro] Tece as conclusões de vários diferentes campos acadêmicos em um argumento provocativo…”, segundo um review da obra, que apesar dos pesares, também foi chamada de “sensacionalista”.

Caricatura

Muitos antropólogos acusaram Davis de caricaturar o Vodu como um sistema cultural fechado desde o século 18, desconectado de todas as formas de mudança social de política do Haiti.

TTX

O grande trunfo da ideia era tentar relacionar o comportamento zumbi com um efeito de uma neurotoxina, só que isso não deu muito certo. Um estudo feito por dois eminentes toxicologistas japoneses testou oito amostras do veneno zumbi que Davis coletou e encontrou a presença de TTX em apenas uma das amostras, e mesmo assim, o meio alcalino em que essa substância se encontrava a deixava farmacologicamente inativa. Isso sem falar que Davis foi acusado de forjar os resultados da presença de TTX em sua tese de PhD, apresentando os resultados antes de serem confirmados.

Questão Cultural

Alguns críticos disseram que o coquetel de substâncias era um grande efeito placebo associado a alucinógenos: só funcionava porque as pessoas realmente temiam ser transformadas em zumbi e realmente acreditavam na existência de mortos-vivos. Davis dizia que o efeito cultural tinha enorme influência no funcionamento do “zombie poison”, para ser realmente algo “zumbificante”. Críticos rebateram o argumento dizendo que não fazia nenhum sentido uma substância como a TTX – que em certas concentrações pode matar – “não fazer efeito” por uma questão cultural.

Prova

Algo que irritou profundamente os críticos foi a posição de Davis em rebater as críticas à falta de provas envolvendo a TDT. Segundo ele, assim como ele não provou nada, os críticos não provaram o contrário para refutar suas teorias. Péssimo argumento.

Assim fica difícil confirmar os efeitos relatados por Davis em sua pesquisa. Alguns dizem que grande parte da resistência acadêmica ao seu trabalho provinha da quebra de protocolos científicos referente ao estilo de relato científico de Davis, outros ainda afirmam que se a mesma pesquisa tivesse sido realizada dez anos depois, a comunidade científica da etnofarmacologia (campo interdisciplinar que une áreas quase incompatíveis, nova na época) seria mais flexível e se comportaria diferente em relação à pesquisa e como foi feita. Mesmo assim, é um jeito possível – falta provar! – de criar zumbis de verdade, mesmo que temporariamente (isso se houver sobrevivência!). Só que isso ainda está longe de criar um apocalipse.

Doenças Bizarras Hipotéticas

"Warning: Zombies!"

Um apocalipse zumbi só pode acontecer com uma doença fulminantemente transmissível e que dê características de um zumbi ao infectado. De todos os filmes, séries, livros e jogos sobre zumbis, a teoria mais interessante que explica sua existência é aquela envolvendo o vírus da raiva: essa doença é perfeita como vetor zumbificante! Partindo do pressuposto que um zumbi é um ser humano doente, agressivo  e psicótico o suficiente (perdendo até mesmo sua “personalidade”) para continuar seu comportamento agressivo mesmo quando severamente sequelado; a raiva se encaixaria muito bem em muitas dessas características. Isso sem falar no quesito biológico: ela age no sistema nervoso e se transmite pela saliva! Logo, mordida = infecção, igual a todo bom zumbi que se vê por aí na cultura pop.

O que falta então para termos uma epidemia de raiva que gere zumbis!? Três coisas: letalidade, efeitos no sistema nervoso e principalmente: a transmissibilidade do vírus.

Sendo menos letal, ou seja, demorando mais para matar o indivíduo (ou quem sabe, nem chegando a o matar), poderíamos ter zumbis que vivessem o suficiente para causarem estrago por aí. Também, se o efeito causado no sistema nervoso central se espalhasse para regiões específicas do cérebro, seria possível causar os comportamentos dementes e animalescos dos zumbis. Mas o grande fator pandêmico de tudo seria a transmissão da doença. Ultimamente, tornar super transmissível uma doença em laboratório é o grande “tiro pela culatra” do momento nos esforços em tentar fazer o oposto: combater doenças. Isso é um grande problema de…

Biossegurança

Gripe Aviária provocada pelo H5N1

Um recente trabalho submetido para publicação na Science causou grande alarde mostrando como fazer o vírus da gripe aviária (H5N1) se tornar extremamente contagioso com apenas cinco mutações “fáceis” no código genético do vírus. A pesquisa foi prontamente passada para a supervisão da americana NSABB (National Science Advisory Board for Biosecurity), e ainda há o debate entre os benefícios e malefícios da publicação de tal conteúdo, que poderia ser utilizado para construir uma arma biológica.

Com um índice de letalidade quase chegando aos 60% – controvérsias à parte, segundo outros dados, esse número poderia ser bem menor devido à um grande número de pessoas infectadas mas que não mostraram sintomas -, uma epidemia de H5N1 seria devastadora. Imagine então se fosse possível fazer o mesmo com o nosso vírus hipotético da raiva: estaríamos perdidos. Se duvida, veja o resultado de alguns modelos matemáticos simplificados envolvendo um apocalipse zumbi no Meio de Cultura.

Some a tudo isso a grande facilidade que a Biologia Sintética traz à engenharia genética. Com a padronização de partes biológicas, métodos rápidos de síntese de DNA e o crescente desenvolvimento de técnicas de biologia molecular, é extremamente mais fácil para um bioterrorista iniciar desde um  hipotético apocalipse zumbi até a uma super gripe aviária em sua própria “garagem”! O que devemos dar importância na verdade é na regularização dessas atividades, que apesar de revolucionárias, também podem ser usadas para o mal como todo grande avanço da ciência. Segundo uma recente publicação em um dos blogs da Nature, até mesmo nos EUA as políticas envolvendo biologia sintética estão devagar demais para serem implementadas. Imagine no Brasil, que nem conhece direito Synbio, e que ainda luta para conter epidemias menos letais, como a dengue.

Se 2012 é realmente o último dos anos como os Maias dizem, é melhor não acelerar o processo nesse carnaval. É a época perfeita não só para iniciar um apocalipse zumbi, mas também ideal para qualquer doença “menos pior” (ou nem tanto). Também, dado o conjunto de particularidades que devem acontecer simultaneamente para existir uma doença zumbificante, é melhor se preocupar em não se tornar um morto-vivo, mas em um “morto-morto” mesmo! Ou pelo menos em não ficar tão estúpido quanto um zumbi.

 

Referências

Papers

Albuquerque, UP. et al. (2011). Natural Products from Ethnodirected Studies: Revising the Ethnobiology of the Zombie Poison Evidence-Based Complementary and Alternative Medicine, 2012 : 10.1155/2012/202508

Inglis D (2010).The Zombie from Myth to Reality: Wade Davis, Academic Scandal and the Limits of the Real scripted, 7 (2) : 10.2966/scrip.070210.351

Sites

Nature News Blog: “Report finds US slow to implement synthetic biology policies

NewScientist: “Five easy mutations to make bird flu a lethal pandemic

Info: “Cientista cria vírus H5N1 mutante, super contagioso

 

Blogagem coletiva Fim do Mundo

Esse foi um post da blogagem coletiva “2012: o último carnaval?” promovida pelo ScienceBlogs Brasil, com a colaboração especial do desenhista Pedro Pantai, que elaborou a primeira imagem desse post. Clique nela para acessar o blog de tirinhas do artista.

DNA como Código de Barras

DNA barcodeDesde o incrível advento do sequenciamento gênico lá pelos idos dos anos 70 o volume de dados obtidos das mais variadas combinações de nucleotídeos encontradas na natureza é estonteante. Fazendo um cálculo bem simples com só cinco nucleotídeos, temos 3125 combinações diferentes das letrinhas A,T,C e G!

É lógico que hoje também conhecemos uma enorme quantidade de padrões dessas letrinhas que nos dizem: “Olha, aqui termina um gene!”, ou “É aqui que o ribossomo gruda!”, entre outras coisas. O ruim é que só à partir do DNA é bem mais trabalhoso e difícil dizer de qual criatura vieram aquelas informações encriptadas ali quando comparada à mera observação daquele ser vivo. E em alguns casos, mesmo que se conheça de onde vem o DNA, há a dúvida se ele veio mesmo de onde parece ter vindo: como se poderia ter certeza, por exemplo, se aquela bonita carteira de couro que te deram de presente não veio de uma espécie de jacaré em extinção em vez de um réptil criado em cativeiro!? A grande ideia é fazer o mesmo que você faz quando vai ao supermercado: em vez de escanear cada dobra da embalagem, abri-la, fazer uma fina análise do conteúdo, além de ter que sair por aí perguntado quanto custa, basta colocar aquela figurinha cheia de barras que existe em algum canto da embalagem num detector e pronto! Você passa a saber com rapidez do que se trata aquilo. No código genético tenta se fazer a mesma coisa.

A Vida Rotulada

A região do DNA (lócus) que deve ser usada para ser um “código de barras” (CB) tem que ao mesmo tempo ser conservada e variável, do mesmo modo que os CB’s são todos barrinhas pretas de mesmo tamanho, mas com comprimentos e espaçamentos variáveis. Essa região pode variar com os reinos dos seres vivos, mas no caso dos eucariotos, a região de 648 pares de bases do DNA mitocondrial que codifica a subunidade 1 da enzima citocromo mitocondrial C oxidase, é hoje amplamente usada como código de barras. O DNA mitocondrial é ideal para ser usado como CB uma vez que sua taxa de mutação nos seres vivos durante a evolução é muito alta, o que resulta em uma variação significativa das sequências entre as espécies.

Rotulando uma parte pelo todo é muito mais fácil para os biólogos associarem uma marca única de cada espécie às suas já elaboradas classificações do zoológico da vida, além de tornar muito mais fácil o controle, detecção e proteção de várias espécies de animais. Exitem grandes bancos de dados com um número crescente de DNA Barcodes (códigos de barras de DNA), um dos mais notórios é o projeto International Barcode of Life (Com site muito bonito aliás!) que já conta – pelo menos até agora pouco quando dei uma olhada – cerca de 1 milhão e 330 mil espécies no catálogo.

Código de Barras Literal

Aqui é o ponto em que a biologia sintética, ou pelo menos a engenharia genética, entra nisso tudo: como rotular os transgênicos? Bem, esse é um probleminha que foi bem discutido nos últimos anos que se passaram, principalmente porque as indústrias não queriam facilitar que sua tecnologia fosse copiada por outras companhias, enquanto governos e opinião pública queriam uma regulamentação que gerassem medidas que discriminassem um produto transgênico de um não-transgênico – um pouco por motivos ideológico-sociais, mas principalmente por motivos ecológicos: tornando a possibilidade de rastrear os culpados na hipótese de uma contaminação em certeza, haveria uma maior pressão para execução adequada das medidas de segurança impostas pela lei.

Foi aí então que criaram – ou melhor patentearam – uma padronização para códigos de barras bem interessante, que além de naturalmente tornar a identificação do transgênico muito mais fácil à partir de uma simples amostra de DNA, mantém a tecnologia em segredo e ainda conta com os mesmos processos utilizados em computador para correção de dados e compactação dos mesmos. Além dessa padronização que iremos explicar adiante, o próprio pessoal do Registro de Partes Padrão desenvolveu um Barcode para os Biobricks, que não é tão sofisticado, mas que corresponde à sua finalidade.

Escrevendo Com Quatro Letras

Para escrever textos com apenas quatro letras é muito simples se você sabe escrever

Imagem modificada retirada de http://tinyurl.com/3g46mnj

letras com números. Os computadores usam uma tabela que traduz o valores numéricos (ou melhor, bits) associados à um caractere do alfabeto alfanumérico: a famosa tabela ASCII. Para escrever letras no DNA então é muito mais fácil que no computador, principalmente porque ele utiliza o sistema binário de contagem, enquanto no DNA é possível usar o quaternário, com os 4 “números” possíveis: A, T, C e G, valendo 0, 1, 2, e 3 respectivamente (ver figura ao lado).

Com isso foi possível criar a seguinte (ver imagem abaixo) construção não-codificante de DNA que conta com informações relativas à por exemplo o nome da companhia, a espécie que foi modificada, ao ano em que o transgênico foi construído, e qual construção é aquela dentre todas as que a empresa possui. Ou seja, tudo aquilo que um código de barras em um transgênico precisa ter.

Código de Barras no DNA

Imagem modificada retirada de http://tinyurl.com/3g46mnj

No caso da imagem acima, o sistema binário de contagem foi utilizado, em que 1 é a sequência TGT e 0 é TAC. Os números 1, 3 e 1 do nome da empresa, espécie e construção gênica seriam consultados em banco de dados, de modo a identificar produtor do transgênico.

Esse tema foi até um projeto do iGEM, realizado pelo time de Hong Kong em 2010, cuja a grande ideia foi criar um processo que literalmente criptografa dos dados inseridos em DNA através da ação de uma recombinase. Além disso desenvolveram um programinha que converte os dados de caracteres (char) à números quaternários, disso à ATCG e depois à uma versão compactada da sequência (Quanto maior e mais repetitivo o texto, melhor é a compactação, se o texto for pequeno e pouco repetitivo a compactação vai fazer o trabalho oposto); vale a pena dar uma olhadinha (nesse link aqui ó: http://2010.igem.org/Team:Hong_Kong-CUHK/Model).

Synbiobrasil no “alfabeto nucleotídico” é TTAGTGCTTCGCTCACTCCTTCGGTCACTGACTCATTGAGTCCTTCGA (grande né!?). 🙂

À Prova de Erros

Tanto em computadores como no sequenciamento genético erros podem acontecer, em que um 1 pode se tornar um 0 ou um A pode se tornar T (apesar de isso acontecer com muito mais frequência no DNA). Em ambos usa-se os mesmos métodos que podem identificar o erro, e se for pequeno, repará-lo, possibilitando a leitura correta da informação. Esses métodos chamam-se Checagem de Pares e Códigos Convolucionais, e utilizam bits… ops, quer dizer, utilizam números secundários usados para verificar a consistência dos dados. Têm-se então os números fonte (f), que são os que contém a informação a ser lida e os número de checagem de paridade (p), estes últimos têm valor 1 se um conjunto determinado de números fonte tiverem uma quantidade ímpar de 1s (“ums”) e zero se o contrário.

Na checagem de pares o negócio funciona com números de checagem verificando blocos de código. Por exemplo: os números fonte 1001 (f1 f2 f3 f4) são verificados por três números de checagem: p1, que verifica os três primeiros dígitos, p2 que verifica a paridade do primeiro, segundo e quarto dígitos, e p3 que verifica o primeiro, terceiro e quarto dígitos. Temos então o seguinte código de checagem de pares: 1001100 (números de checagem em itálico), pois:

  • f1(1) + f2(0) + f3(0) = p1 (1), pois se tem “um 1”
  • f1(1) + f2(0) + f4(1) = p2 (0), pois se tem “dois 1s”
  • f1(1) + f3(0) + f4(1) = p3 (0), pois se tem “dois 1s”

Durante a leitura se não houver correlação entre os números de checagem e fonte, é possível dizer onde aconteceu o erro (caso o erro não seja generalizado). No exemplo foi utilizado um bloco de tamanho 4, mas ele pode ser maior, o que aumenta também o tamanho do código de checagem.

Utilizando Códigos de Convolução o processo é bem parecido, mas não ocorre em blocos, nele cada fn possui um pn que verifica os dois números fonte predecessores. Por exemplo, o número 1011 ficaria: 11011110 (f1 p1 f2 p2 f3 p3 f4 p4), pois:

  • f1(1) = p1(1), pois se tem “um 1”
  • f1(1) + f2(0) = p2(1), pois se tem “um 1”
  • f2(0) + f3(1) = p3(1), pois se tem “um 1”
  • f3(1) + f4(1) = p4(0), pois se tem “dois 1s”

Ensinando o computador a fazer os cálculos, utilizando esses dois métodos, e fazendo a conversão de zeros e uns para nucleotídeos (e vice-versa) é possível criar um sistema de leitura do sequenciamento genético do código de barras à prova de erros, preservando a informação original inserida na célula.

DNA “Zipado”

Assim como muita coisa na biologia sintética, os mesmos princípios da computação também podem ser aplicados na decodificação de informações inseridas em DNA. O mesmo algoritmo de compactação de arquivos usado na computação também pode ser usado para compactar as informações a serem inseridas em DNA, salvando espaço, tempo de leitura e dinheiro no bolso das empresas. É o amplamente conhecido Algoritmo de Codificação de Huffman (veja o link!), que se baseia no encurtamento de códigos bastante frequentes de um arquivo através de um algoritmo recursivo que constrói a “Árvore de Huffmam“, uma ramificação binária de nós de dados que contém informações relativas às frequências de caracteres. É preciso um pouco de conhecimento de programação para entender melhor como ele funciona; e isso foge um pouco do escopo desse post. Mas basta entender que você pode “zipar” as informações dentro do DNA!

Vale muito a pena conferir os links abaixo se você quiser saber mais sobre o assunto:

E até o próximo post!
Ou como se diria em 72 pares de base:
TAATTGTAGCCTACAATCGGACAATGAATGACGGAGTGCATCCTTCGTTCGGACAATGAATCGGTGAGTGTA!

As 50 empresas mais quentes de bioenergia

Acabou de sair um ranking de empresas que reconhece a inovação e os avanços em  bioenergia. Entre as 50, 37 são dos EUA, 15 são ativas no desenvolvimento do etanol celulósico, 5 desenvolvem algas para soluções energéticas e 16 produzem novos biocombustíveis avançados como o biobutanol,  biodiesel, gasolina e combustíveis de jato renováveis.

Veja a reportagem completa:

http://biofuelsdigest.com/bdigest/2010/12/07/the-50-hottest-companies-in-bioenergy-for-2010-11/

The 50 Hottest Companies in Bioenergy for 2010-11 are:

Last year’s rank (2009-10)

1.            Amyris                              3

2.            Solazyme                          1

3.           POET                                 2

4.            LS9                                    8

5.            Gevo                                 13

6.            DuPont Danisco            7

7.            Novozymes                       11

8.             Coskata                             6

9.             Codexis                            35

10.            Sapphire Energy            5

11.             Virent                              21

12.             Mascoma                        10

13.             Ceres                                28

14.             Cobalt Technologies     30

15.             Honeywell’s UOP           12

16.             Enerkem                          25

17.             BP Biofuels                        4

18.             Genencor                         26

19.             Petrobras                          18

20.             Abengoa Energy             15

21.             Qteros                                22

22.             Joule Unlimited              32

23.             Shell                                    27

24.             Bluefire Renewables        19

25.             Rentech                              38

26.             Algenol                                24

27.             ZeaChem                             20

28.             PetroAlgae                          16

29.             Neste                                    29

30.             Synthetic Genomics           17

31.             LanzaTech                            41

32.             Iogen                                    23

33.             OriginOil                             42

34.             RangeFuels                         14

35.             ExxonMobil                        29

36.             Cargill                                    NR

37.             SG Biofuels                          49

38.             Butamax                              38

39.             Terrabon                              47

40.             Cosan                                    NR

41.             Verenium                              9

42.             Waste Management            42

43.             IneosBio                                36

44.             Dynamic Fuels                     NR

45.             Fulcrum Bioenergy              48

46.             KL Energy                             34

47.            KiOR                                       NR

48.             Chevron                                 NR

49.             Monsanto                              NR

50.             Inbicon                                    50

Palestra de pesquisadora do MIT sobre biologia sintética

Nesta segunda-feira, às 10:00 no anfiteatro 2 do ICBII (no centro didático anexo) teremos o grande prazer de receber a pesquisadora do MIT Meagan Lizarazo, que falará sobre Biologia Sintética, iGEM, Registro de Partes Padrão e outras coisas interessantes.

Não percam!

Reunião no dia 10/03, dispositivos sintéticos: osciladores e dinâmica

Olá pessoal, está confirmada para o dia 10/03, logo após o carnaval, a nossa terceira reunião do Synbio Science Club. As reuniões voltarão a ser na sala 101 aqui no ICBII na USP.

  • 10/03/2011, 3 pm, Oscillators & Dynamics

A Synthetic Oscillatory Network of Transcriptional Regulators. Elowitz MB, Leibler S. Nature. 403:335-8. (2000).

A fast, robust and tunable synthetic gene oscillator. Stricker J, Cookson S, Bennett MR, Mather WH, Tsimring LS, Hasty J. Nature. 456:516-19 (2008).

Nos vemos lá!

Clube de Biologia Sintética da Universidade de São Paulo!

Agora é oficial! Foi aprovado pelo conselho do Departamento de Microbiologia da Universidade de São Paulo o nosso Clube Científico de Biologia Sintética. A partir de agora, poderemos divulgar, reservar uma sala para as reuniões e receber nossos colegas da Poli e outros Institutos para discutirmos synbio!

SynbioBrasil Science Club: Participe!

Dispositivos sintéticos: interruptores de expressão gênica

Só agora tive tempo para fazer um post sobre a nossa segunda reunião do Clube Científico de Biologia Sintética da USP que, com certeza, vai render alguns posts.  Conversamos sobre uma das primeiras construções genéticas de biologia sintética visando a robustez no controle de expressão: a construção de um interruptor genético (toggle switch, flip flop,..). Robusto porque é capaz de funcionar corretamente a partir do modelo apesar de várias incertezas do sistema.

Mas para entender o dispositivo, vou comentar alguns conceitos básicos de biologia molecular: (i) promotores são regiões do DNA que antecedem os genes e são reconhecidas pela RNA polimerase e um fator sigma associado para facilitar a transcrição do gene, (ii) transcrição é processo de criação de um RNA complementar a sequência de DNA que posteriormente pode ser traduzido por um ribossomo a uma proteína, finalmente, (iii) um repressor é uma proteína de ligação de DNA que regula a expressão de genes, através da ligação a um operador, e bloqueia a ligação da RNA polimerase no promotor, impedindo a transcrição de genes.

Utilizando esses conceitos básicos de biologia molecular, Gardner e colaboradores (2000) construíram um interruptor para regular a transcrição de genes em E. coli. Chama-se um interruptor porque possuiu dois pontos de equilíbrio (acesso ou apagado, direita ou esquerda, expressão de X ou expressão de Y). Vou dar o exemplo de apenas uma das construções, em que o repressor 2 (repressor LacI) reprime o promotor 2 (Ptrc-2), e o repressor (repressor Tet) reprime o promotor 1 (PltetO-1).  A substância IPTG (Indutor 2) inibe o repressor 2 e aTC (Indutor 1) inibe o repressor 1 (ver Figura abaixo).

Dessa maneira, basicamente, temos dois pontos de equilíbrio: (i) com a presença de aTC, o repressor 2 é transcrito e ocorre a repressão do promotor 2, não havendo assim a transcrição do gene repórter (no caso uma proteína luminescente GFP); (ii) e na presença de IPTG em que ocorre a transcrição do promotor 2, e conseqüente transcrição de GFP e do repressor 1.

Dessa maneira, existem dois estágios: aceso (transcrição de GFP) e apagado (sem transcrição de GFP). Este sistema é robusto porque funciona de acordo com o modelo proposto:

Onde u é a concentração do repressor 1, v é a concentração do repressor 2, α1 é a taxa efetiva de transcrição do repressor 1, α2 é a taxa efetiva de transcrição do repressor 2, β é taxa de cooperatividade da repressão do promotor 2 e γ é taxa cooperatividade de repressão do promotor 1. A ação deste modelo corresponde a seguinte estrutura gráfica:

Este gráfico representa os dois pontos de equilíbrio do sistema, o estado 1 e o estado 2 (aceso e apagado, na presença de um dos indutores) e um outro ponto instável de equílibrio que mostra os dois repressores se regulando mutuamente. Seria mais fácil de entender se houvesse, de uma lado uma proteína luminescente verde e  do outro lado do dispositivo uma proteína luminescente amarela. Os estados de equilibro 1 e 2 representam verde ou amarelo, enquanto o ponto instável de equilíbrio representa a ausência de cor.

Este tipo de dispositivo pode ser utilizado na biotecnologia para regular vias metabólicas inteiras, ligando e desligando vias de acordo com um sinal externo; ou na medicina para acionar a resposta a um remédio por exemplo. Funcionam de uma maneira mais eficiente do que o controle via promotores específicos. No próximo post, vou comentar a utilização desse dispositivo para desenvolver uma bactéria que conta!

Construction of a genetic toggle switch in Escherichia coli. Gardner TS, Cantor CR and Collins JJ. Nature 403: 339-342 (2000).

Do-it-yourself biologists (DIYbio) e a ciência cidadã

ResearchBlogging.org

Neste momento, em algum lugar dos Estados Unidos, da Inglaterra ou até da Índia, algum biólogo sintético amador está realizando um experimento na sua cozinha ou garagem. Nos últimos dois anos, entusiastas da biologia molecular têm se juntado para montar organizações de biologia sintética amadora, como o DIYbio (do-it-yourself biology), em que os membros se reúnem em pubs e barbecues para discutir os últimos experimentos realizados nas suas próprias garagens. Há quase seis meses tenho participado das discussões desse grupo, que apresentam conteúdo refinado e objetivo sobre o desenvolvimento de microscópios de 10 dólares, espectrofotômetros, centrífugas de furadeiras ou liquidificadores, construções de diferentes kits com E. coli modificada, chegando até a sequenciadores de DNA caseiros.

Inspirados pelos grandes avanços realizados em garagens pelos fundadores de atuais gigantes da informática, os também chamados biohackers pretendem revolucionar a ciência através de experimentos e idéias não-convencionais aplicados a biologia sintética.

Este movimento também se caracteriza pela chamada ciência cidadã (minha tradução de citizen science), em que os cidadãos ativamente participam no papel de desenvolver a ciência e as novas tecnologias. Além disso, a ciência cidadã estimula o apoio da população à ciência, o desenvolvimento do pensamento científico nas pessoas, além de introduzir novas idéias de diferentes disciplinas ao assunto. Utilizando a Internet como plataforma, um simples projeto de ciências pode envolver dezenas, centenas e milhares de pessoas de diversas formações no mundo dispostas a criar algo novo e interessante.

Porém, junto com o crescimento da ciência cidadã, tem também aumentado a preocupação do governo americano e do FBI a respeito do que os biohackers estão fazendo. Por incrível que pareça, agentes do FBI têm comparecido a reuniões do DIYbio para entender o que as pessoas estão fazendo e qual a possibilidade de utilização das ferramentas para o bioterrorismo. A comunidade DIYbio teme que o foco constante em possíveis atividades terroristas desvie a atenção dos tópicos importantes relacionados com biossegurança: como o descarte de bactérias geneticamente modificadas, normatização/legalização de laboratórios caseiros e equipamentos de segurança mais acessíveis e baratos.

Muitas vezes o que tem acontecido é que não existe nenhum tipo de norma ou lei que fale a respeito de laboratórios caseiros para a utilização de bactérias geneticamente modificadas.

Eu acho incrível o que está acontecendo neste momento. Não só está ocorrendo uma explosão de conhecimento e técnicas no mundo científico, mas também a população está cada vez mais interessada em fazer parte dessas descobertas e fazer da ciência um exercício cotidiano.

Ledford, H. (2010). Garage biotech: Life hackers Nature, 467 (7316), 650-652 DOI: 10.1038/467650a

Editorial, Nature (2010). Garage biology Nature, 467 (7316), 634-634 DOI: 10.1038/467634a

Sobre ScienceBlogs Brasil | Anuncie com ScienceBlogs Brasil | Política de Privacidade | Termos e Condições | Contato


ScienceBlogs por Seed Media Group. Group. ©2006-2011 Seed Media Group LLC. Todos direitos garantidos.


Páginas da Seed Media Group Seed Media Group | ScienceBlogs | SEEDMAGAZINE.COM